Skip to main content
Addgene

pEGFPC2-gephyrin S268A/270A
(Plasmid #199608)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199608 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFPC2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gephyrin
  • Species
    R. norvegicus (rat)
  • Mutation
    S268A/S270A
  • Entrez Gene
    Gphn (a.k.a. Geph)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ACCCTAACTGACACACATTCC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFPC2-gephyrin S268A/270A was a gift from Shiva Tyagarajan (Addgene plasmid # 199608 ; http://n2t.net/addgene:199608 ; RRID:Addgene_199608)

  • For your References section:

    Extracellular signal-regulated kinase and glycogen synthase kinase 3beta regulate gephyrin postsynaptic aggregation and GABAergic synaptic function in a calpain-dependent mechanism. Tyagarajan SK, Ghosh H, Yevenes GE, Imanishi SY, Zeilhofer HU, Gerrits B, Fritschy JM. J Biol Chem. 2013 Apr 5;288(14):9634-47. doi: 10.1074/jbc.M112.442616. Epub 2013 Feb 13. 10.1074/jbc.M112.442616 PubMed 23408424
Related items:
Commonly requested with: