Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSuperRetropuro-IL-6 scramble
(Plasmid #19960)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 19960 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PSuperRetroPuro
  • Backbone size w/o insert (bp) 5100
  • Vector type
    Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pSuperRetropuro-IL-6 scramble
  • Alt name
    IL-6 shRNA
  • Alt name
    interleukin-6 shRNA
  • gRNA/shRNA sequence
    AGACGGAGGCTTACAGTCTGG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    30

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (unknown if destroyed)
  • 3′ cloning site Bgl II (unknown if destroyed)
  • 5′ sequencing primer pLXSN5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

scramble control sequence is - 5′-AGACGGAGGCTTACAGTCTGG-3′

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSuperRetropuro-IL-6 scramble was a gift from Christopher Counter (Addgene plasmid # 19960 ; http://n2t.net/addgene:19960 ; RRID:Addgene_19960)
  • For your References section:

    Oncogenic Ras-induced secretion of IL6 is required for tumorigenesis. Ancrile B, Lim KH, Counter CM. Genes Dev. 2007 Jul 15. 21(14):1714-9. 10.1101/gad.1549407 PubMed 17639077