-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 19960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonePSuperRetroPuro
- Backbone size w/o insert (bp) 5100
-
Vector typeRetroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepSuperRetropuro-IL-6 scramble
-
Alt nameIL-6 shRNA
-
Alt nameinterleukin-6 shRNA
-
gRNA/shRNA sequenceAGACGGAGGCTTACAGTCTGG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)30
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (unknown if destroyed)
- 3′ cloning site Bgl II (unknown if destroyed)
- 5′ sequencing primer pLXSN5' (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
scramble control sequence is - 5′-AGACGGAGGCTTACAGTCTGG-3′
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSuperRetropuro-IL-6 scramble was a gift from Christopher Counter (Addgene plasmid # 19960 ; http://n2t.net/addgene:19960 ; RRID:Addgene_19960) -
For your References section:
Oncogenic Ras-induced secretion of IL6 is required for tumorigenesis. Ancrile B, Lim KH, Counter CM. Genes Dev. 2007 Jul 15. 21(14):1714-9. 10.1101/gad.1549407 PubMed 17639077