pCambia-loxKan
(Plasmid #199590)

• Purpose: basic plant vector with a plant-selectable kanamycin resistance cassette flanked by both loxP and FRT sites for sustainable plant engineering with subsequent marker removal possibility
• Depositing Lab: Andreas Stuermer
• Publication: Plant vector with removable kanamycin resistance cassette (unpublished)

Backbone

• Vector backbone: pCambia1302
• Backbone manufacturer: Cambia Foundation
• Backbone size w/o insert (bp): 8620
• Total vector size (bp): 10184
• Vector type: Plant Expression, Cre/Lox
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: Room Temperature
• Growth Strain(s): DH5alpha
• Growth instructions: Can grow in E.coli (high copy) but also in Agrobacterium (low copy), as normal pCambia vectors. Selection is kanamycin containing LB in E. coli and Agrobacterium
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FRT-lox66-NosP-KanR-NosT-lox71-FRT
• Alt name: removable kanamycin resistance cassette
• Species: Synthetic
• Insert Size (bp): 1564
• Promoter: Nos

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ctagagcagcttgccaacatgg
• 3′ sequencing primer: ctagaattcgagctcagcgttcc

Resource Information

• Supplemental Documents:
  • pCambia-loxKan.gb
• A portion of this plasmid was derived from a plasmid made by: synthetic DNA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA