Skip to main content
Addgene

pAAV_tKiMBImut-T2A-caMEK
(Plasmid #199579)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199579 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 7242
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ERK tdTomato-Kinase-Modulated Bioluminescent Indicator (mutant)
  • Alt name
    ERK tKiMBImut
  • Species
    Synthetic
  • Insert Size (bp)
    2112
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTGGCTAACTAGAGAACCCA
  • 3′ sequencing primer GGAAGAAAACCCAGGGCCT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    constitutively active MEK
  • Alt name
    caMEK
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1176
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCCGGATCCGGTGAAGGTC
  • 3′ sequencing primer AGCCATCTGTTGTTTGCCCCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_tKiMBImut-T2A-caMEK was a gift from Michael Lin (Addgene plasmid # 199579 ; http://n2t.net/addgene:199579 ; RRID:Addgene_199579)
  • For your References section:

    Kinase-Modulated Bioluminescent Indicators Enable Noninvasive Imaging of Drug Activity in the Brain. Wu Y, Walker JR, Westberg M, Ning L, Monje M, Kirkland TA, Lin MZ, Su Y. ACS Cent Sci. 2023 Mar 20;9(4):719-732. doi: 10.1021/acscentsci.3c00074. eCollection 2023 Apr 26. 10.1021/acscentsci.3c00074 PubMed 37122464