pAAV_tKiMBI-T2A-caMEK
(Plasmid #199578)

• Purpose: Express tKiMBI and caMEK in an AAV vector
• Depositing Lab: Michael Lin
• Publication: Wu et al ACS Cent Sci. 2023 Mar 20;9(4):719-732. doi: 10.1021/acscentsci.3c00074. eCollection 2023 Apr 26.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 7242
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: ERK tdTomato-Kinase-Modulated Bioluminescent Indicator
• Alt name: ERK tKiMBI
• Species: Synthetic
• Insert Size (bp): 2112
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: TCTGGCTAACTAGAGAACCCA
• 3′ sequencing primer: GGAAGAAAACCCAGGGCCT

Gene/Insert 2

• Gene/Insert name: constitutively active MEK
• Alt name: caMEK
• Species: H. sapiens (human)
• Insert Size (bp): 1176
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CCGGTGAAGGTCGAGGCTC
• 3′ sequencing primer: AGCCATCTGTTGTTTGCCCCT

Resource Information

• Supplemental Documents:
  • paav-cmv-tdtomato-erk_kimbi-t2a-camek-bgh_pa.gb
  • paav-cmv-tdtomato-erk_kimbi-t2a-camek-bgh_pa.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry