pPIPL12-FnCas12a
(Plasmid
#199563)
-
PurposeTetracycline-Inducible Fncas12a gene expression in E. coli and clostridia
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199563 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGG3221
- Backbone size w/o insert (bp) 4200
- Total vector size (bp) 8909
-
Modifications to backboneBased on vectors pGG2121 and pMTL83221
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology ; Tetracycline Inducible
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 300 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor use in C. sporogenes and C. butyricum, use 15-20 μg/mL Erythromycin
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFncas12a
-
Alt nameFncpf1
-
SpeciesFrancisella novicida
-
Insert Size (bp)4750
-
GenBank IDUVJ64948.1
- Promoter COtetR-PIPL12
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGTCTCGACATATGTCAATTTATCAAGAATTTGTTAATAAATATAG
- 3′ sequencing primer CGTCTCGGTCTTTAGTTATTCCTATTCTGCACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPIPL12-FnCas12a was a gift from Philippe Lambin (Addgene plasmid # 199563 ; http://n2t.net/addgene:199563 ; RRID:Addgene_199563) -
For your References section:
Development of a CRISPR-Cas12a system for efficient genome engineering in clostridia. Zhang Y, Kubiak AM, Bailey TS, Claessen L, Hittmeyer P, Dubois L, Theys J, Lambin P. Microbiol Spectr. 2023 Nov 10:e0245923. doi: 10.1128/spectrum.02459-23. 10.1128/spectrum.02459-23 PubMed 37947521