PB513B-1/TRE-hHNF1β-hHNF4α-hHNF6-EF1α-Bla
(Plasmid #199551)

• Purpose: PiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1β-hHNF4α-hHNF6) under control of the TRE/PCMVmin promoter
• Depositing Lab: Masamichi Kamihira
• Publication: Kitano et al Cells. 2022 Apr 1;11(7):1194. doi: 10.3390/cells11071194.

Backbone

• Vector backbone: PB513B-1
• Backbone manufacturer: SBI
• Vector type: Mammalian Expression ; PiggyBac transposon vector
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hHNF1β-hHNF4α-hHNF6
• Species: H. sapiens (human)
• Entrez Gene: ONECUT1 (a.k.a. HNF-6, HNF6, HNF6A)
• Entrez Gene: HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
• Entrez Gene: HNF1B (a.k.a. ADTKD3, FJHN, HNF-1-beta, HNF-1B, HNF1beta, HNF2, HPC11, LF-B3, LFB3, MODY5, RCAD, T2D, TCF-2, TCF2, VHNF1)
• Promoter: TRE+CMVmin promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CCCAGTCACGACGTTGTAAAACG
• 3′ sequencing primer: AGCGGATAACAATTTCACACAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry