PB513B-1/TRE-hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBPγ-EF1α-Puro
(Plasmid #199550)

• Purpose: PiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBP-γ) under control of the TRE/PCMVmin promoter
• Depositing Lab: Masamichi Kamihira
• Publication: Kitano et al Cells. 2022 Apr 1;11(7):1194. doi: 10.3390/cells11071194.

Backbone

• Vector backbone: PB513B-1
• Backbone manufacturer: SBI
• Vector type: Mammalian Expression ; PiggyBac transposon vector
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBPγ
• Species: H. sapiens (human)
• Entrez Gene: HNF1A (a.k.a. HNF-1-alpha, HNF-1A, HNF1, HNF1alpha, HNF4A, IDDM20, LFB1, MODY3, TCF-1, TCF1)
• Entrez Gene: FOXA2 (a.k.a. HNF-3-beta, HNF3B, TCF3B)
• Entrez Gene: CEBPB (a.k.a. C/EBP-beta, IL6DBP, NF-IL6, TCF5)
• Entrez Gene: CEBPA (a.k.a. C/EBP-alpha, CEBP)
• Entrez Gene: CEBPG (a.k.a. GPE1BP, IG/EBP-1)
• Promoter: TRE+CMVmin promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CCCAGTCACGACGTTGTAAAACG
• 3′ sequencing primer: AGCGGATAACAATTTCACACAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry