Skip to main content
Addgene

pCA28-pMa-PspCas13b crRNA-TS1
(Plasmid #199459)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199459 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TS1 crRNA
  • gRNA/shRNA sequence
    CCTCCTCGGAGAGCATCGGTGC
  • Species
    H. sapiens (human)
  • Promoter mouse U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCA28-pMa-PspCas13b crRNA-TS1 was a gift from Baohui Chen (Addgene plasmid # 199459 ; http://n2t.net/addgene:199459 ; RRID:Addgene_199459)
  • For your References section:

    Gene activation guided by nascent RNA-bound transcription factors. Liang Y, Xu H, Cheng T, Fu Y, Huang H, Qian W, Wang J, Zhou Y, Qian P, Yin Y, Xu P, Zou W, Chen B. Nat Commun. 2022 Nov 28;13(1):7329. doi: 10.1038/s41467-022-35041-7. 10.1038/s41467-022-35041-7 PubMed 36443367