pHR-iCasp9
(Plasmid
#199441)
-
PurposeExpress inducible Caspase9 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199441 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR-mCherry
- Backbone size w/o insert (bp) 9976
- Total vector size (bp) 11242
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersmCherry Fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameinducible Caspase9
-
SpeciesH. sapiens (human)
-
Entrez GeneCASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
-
Tags
/ Fusion Proteins
- mCherry
- DmrB (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer ATGGCTTCTAGAGGAGTGCA
- 3′ sequencing primer CGCGGATCCCGCTGATGTTTTAAAGAAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a S113R mutation in the DmrB-iCasp9-mCherry insert. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-iCasp9 was a gift from Chao Tang (Addgene plasmid # 199441 ; http://n2t.net/addgene:199441 ; RRID:Addgene_199441) -
For your References section:
Cell-to-cell variability in inducible Caspase9-mediated cell death. Yuan Y, Ren H, Li Y, Qin S, Yang X, Tang C. Cell Death Dis. 2022 Jan 10;13(1):34. doi: 10.1038/s41419-021-04468-z. 10.1038/s41419-021-04468-z PubMed 35013114