pGEX6P-1-eIF4E K119A
(Plasmid #199440)

• Purpose: Bacterial expression plasmids for production of recombinant GST-eIF4E K119A
• Depositing Lab: Shin-ichi Hoshino
• Publication: Bacterial expression plasmids for production of recombinant GST-eIF4E K119A (unpublished)

Backbone

• Vector backbone: pGEX6P-1
• Backbone size w/o insert (bp): 4980
• Total vector size (bp): 5727
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 1977
• Species: H. sapiens (human)
• Insert Size (bp): 747
• Mutation: changed lysine 119 to alanine
• GenBank ID: NM_001968.5
• Entrez Gene: EIF4E (a.k.a. AUTS19, CBP, EIF4E1, EIF4EL1, EIF4F, eIF-4E)
• Tag / Fusion Protein:
  • GST-fusion protein (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: AGCGGATAACAATTTCACACAGG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry