pGEX6P-1-eIF4E K119A
(Plasmid
#199440)
-
PurposeBacterial expression plasmids for production of recombinant GST-eIF4E K119A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199440 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX6P-1
- Backbone size w/o insert (bp) 4980
- Total vector size (bp) 5727
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name1977
-
SpeciesH. sapiens (human)
-
Insert Size (bp)747
-
Mutationchanged lysine 119 to alanine
-
GenBank IDNM_001968.5
-
Entrez GeneEIF4E (a.k.a. AUTS19, CBP, EIF4E1, EIF4EL1, EIF4F, eIF-4E)
-
Tag
/ Fusion Protein
- GST-fusion protein (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer AGCGGATAACAATTTCACACAGG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P-1-eIF4E K119A was a gift from Shin-ichi Hoshino (Addgene plasmid # 199440 ; http://n2t.net/addgene:199440 ; RRID:Addgene_199440) -
For your References section:
Protocol for analyzing intact mRNA poly(A) tail length using nanopore direct RNA sequencing. Ogami K, Oishi Y, Hoshino SI. STAR Protoc. 2023 May 26;4(2):102340. doi: 10.1016/j.xpro.2023.102340. 10.1016/j.xpro.2023.102340 PubMed 37243600