Skip to main content
Addgene

eSpCas9-hGeminin
(Plasmid #199344)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199344 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Total vector size (bp) 9188
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP1A1 G3 sgRNA+user-specified sgRNA+enhanced specificity Cas9 (1.1) (addgene 86613) with cas9 fused to hgem fragment 1-110)
  • Species
    S. pyogenes
  • Insert Size (bp)
    9188
  • Mutation
    cas9 c-term fused to hgemenin 1-110 fragment
  • Entrez Gene
    GMNN (a.k.a. Gem, MGORS6)
  • Promoter cbh
  • Tag / Fusion Protein
    • cas9 c-term fused to hgemenin 1-110 fragment (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAGACAAATGGCTCTAGCTG
  • 3′ sequencing primer CAGCTAGAGCCATTTGTCTGC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene 86613 (eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA) https://www.addgene.org/86613/

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9-hGeminin was a gift from Iain Hagan (Addgene plasmid # 199344 ; http://n2t.net/addgene:199344 ; RRID:Addgene_199344)

  • For your References section:

    Elevated basal AMP-activated protein kinase activity sensitizes colorectal cancer cells to growth inhibition by metformin. Morrison KR, Wang T, Chan KY, Trotter EW, Gillespie A, Michael MZ, Oakhill JS, Hagan IM, Petersen J. Open Biol. 2023 Apr;13(4):230021. doi: 10.1098/rsob.230021. Epub 2023 Apr 12. 10.1098/rsob.230021 PubMed 37042113
Related items: