pSF-CjPglB
(Plasmid #199305)

• Purpose: pSN18 derivative encoding C.jejuni PglB with C-terminal FLAG epitope tag
• Depositing Lab: Michael Jewett
• Publication: Hershewe et al Nat Commun. 2021 Apr 22;12(1):2363. doi: 10.1038/s41467-021-22329-3.

Backbone

• Vector backbone: pSF (pSN18 derivative)
• Backbone size w/o insert (bp): 3987
• Total vector size (bp): 6168
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: CjPglB with flag tag
• Species: C. jejuni
• Insert Size (bp): 2181
• Promoter: pBAD
• Tag / Fusion Protein:
  • Flag tag (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pSF CjPglB backbone is from Ollis, et al. doi.org/10.1038/srep15237

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry