pAKgfplux3
(Plasmid #199304)

• Purpose: Fluorescence and bioluminescence expression in Gram-negative bacteria
• Depositing Lab: Attila Karsi
• Publication: Ozdemir et al Pathogens. 2023 May 2;12(5):670. doi: 10.3390/pathogens12050670.

Backbone

• Vector backbone: pAKgfplux1
• Backbone manufacturer: Karsilab
• Backbone size w/o insert (bp): 11547
• Total vector size (bp): 12240
• Modifications to backbone: A 717 bp fragment containing chloramphenicol resistance gene was amplified from pMJH46 and inserted into broad host range plasmid pAKgfplux1.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Chloramphenicol acetyltransferase
• Alt name: cat
• Insert Size (bp): 717
• GenBank ID:
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: sacI (not destroyed)
• 3′ cloning site: speI (not destroyed)
• 5′ sequencing primer: TCGAGATTTTCAGGAGCTAAGG
• 3′ sequencing primer: AGGGCACCAATAACTGCCTTA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry