Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAKgfplux3
(Plasmid #199304)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199304 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAKgfplux1
  • Backbone manufacturer
    Karsilab
  • Backbone size w/o insert (bp) 11547
  • Total vector size (bp) 12240
  • Modifications to backbone
    A 717 bp fragment containing chloramphenicol resistance gene was amplified from pMJH46 and inserted into broad host range plasmid pAKgfplux1.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Chloramphenicol acetyltransferase
  • Alt name
    cat
  • Insert Size (bp)
    717
  • GenBank ID
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site sacI (not destroyed)
  • 3′ cloning site speI (not destroyed)
  • 5′ sequencing primer TCGAGATTTTCAGGAGCTAAGG
  • 3′ sequencing primer AGGGCACCAATAACTGCCTTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAKgfplux3 was a gift from Attila Karsi (Addgene plasmid # 199304 ; http://n2t.net/addgene:199304 ; RRID:Addgene_199304)
  • For your References section:

    Development of Bioluminescent Virulent Aeromonas hydrophila for Understanding Pathogenicity. Ozdemir E, Abdelhamed H, Ozdemir O, Lawrence M, Karsi A. Pathogens. 2023 May 2;12(5):670. doi: 10.3390/pathogens12050670. 10.3390/pathogens12050670 PubMed 37242340