Skip to main content
Addgene

pGMC00027
(Plasmid #199279)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199279 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    LentiCRISPRV2-mCherry
  • Backbone size w/o insert (bp) 14984
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cd274 guide RNA
  • gRNA/shRNA sequence
    GGCTCCAAAGGACTTGTACG
  • Species
    M. musculus (mouse)
  • GenBank ID
    ENSMUST00000016640.7
  • Entrez Gene
    Cd274 (a.k.a. A530045L16Rik, B7h1, Pdcd1l1, Pdcd1lg1, Pdl1)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGMC00027 was a gift from Raj Chari (Addgene plasmid # 199279 ; http://n2t.net/addgene:199279 ; RRID:Addgene_199279)

  • For your References section:

    Tumor-associated macrophages trigger MAIT cell dysfunction at the HCC invasive margin. Ruf B, Bruhns M, Babaei S, Kedei N, Ma L, Revsine M, Benmebarek MR, Ma C, Heinrich B, Subramanyam V, Qi J, Wabitsch S, Green BL, Bauer KC, Myojin Y, Greten LT, McCallen JD, Huang P, Trehan R, Wang X, Nur A, Murphy Soika DQ, Pouzolles M, Evans CN, Chari R, Kleiner DE, Telford W, Dadkhah K, Ruchinskas A, Stovroff MK, Kang J, Oza K, Ruchirawat M, Kroemer A, Wang XW, Claassen M, Korangy F, Greten TF. Cell. 2023 Aug 17;186(17):3686-3705.e32. doi: 10.1016/j.cell.2023.07.026. 10.1016/j.cell.2023.07.026 PubMed 37595566
Related items: