Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEJS-HZ54 All-in-one AAV-U1a-NmeABE8e-2xBPSV40-U6-Rosa26
(Plasmid #199265)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199265 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 3486
  • Total vector size (bp) 7482
  • Modifications to backbone
    Contains U6-driven sgRNA cassette
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NmeABE8e
  • Alt name
    Nme2Cas9-ABE8e
  • Alt name
    Nme2Cas9c-ABE8e
  • Species
    N. meningitidis
  • Insert Size (bp)
    3996
  • Promoter U1a
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCACCATGaaaagaaccgccga
  • 3′ sequencing primer ACACAAAAAACCAACACACAGATCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS-HZ54 All-in-one AAV-U1a-NmeABE8e-2xBPSV40-U6-Rosa26 was a gift from Erik Sontheimer (Addgene plasmid # 199265 ; http://n2t.net/addgene:199265 ; RRID:Addgene_199265)
  • For your References section:

    Adenine Base Editing In Vivo with a Single Adeno-Associated Virus Vector. Zhang H, Bamidele N, Liu P, Ojelabi O, Gao XD, Rodriguez T, Cheng H, Kelly K, Watts JK, Xie J, Gao G, Wolfe SA, Xue W, Sontheimer EJ. GEN Biotechnol. 2022 Jun 1;1(3):285-299. doi: 10.1089/genbio.2022.0015. Epub 2022 Jun 14. 10.1089/genbio.2022.0015 PubMed 35811581