Skip to main content
Addgene

pEJS-HZ79 All-in-one AAV-U1a-NmeABE8e-2xBPSV40-U6-Rosa26_V2
(Plasmid #199261)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199261 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 3486
  • Total vector size (bp) 7482
  • Modifications to backbone
    Contains U6-driven sgRNA cassette
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NmeABE8e
  • Alt name
    Nme2Cas9-ABE8e
  • Alt name
    Nme2Cas9c-ABE8e
  • Species
    N. meningitidis
  • Insert Size (bp)
    3996
  • Promoter U1a promoter
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gccaccatgaaaagaaccgc
  • 3′ sequencing primer ctagagcgcttacacaaaaaacca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS-HZ79 All-in-one AAV-U1a-NmeABE8e-2xBPSV40-U6-Rosa26_V2 was a gift from Erik Sontheimer (Addgene plasmid # 199261 ; http://n2t.net/addgene:199261 ; RRID:Addgene_199261)
  • For your References section:

    Adenine Base Editing In Vivo with a Single Adeno-Associated Virus Vector. Zhang H, Bamidele N, Liu P, Ojelabi O, Gao XD, Rodriguez T, Cheng H, Kelly K, Watts JK, Xie J, Gao G, Wolfe SA, Xue W, Sontheimer EJ. GEN Biotechnol. 2022 Jun 1;1(3):285-299. doi: 10.1089/genbio.2022.0015. Epub 2022 Jun 14. 10.1089/genbio.2022.0015 PubMed 35811581