pEJS-HZ79 All-in-one AAV-U1a-NmeABE8e-2xBPSV40-U6-Rosa26_V2
(Plasmid
#199261)
-
PurposeOptimized single AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting mouse Rosa26 gene. This optimized construct showed improved in vivo editing efficiency.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 3486
- Total vector size (bp) 7482
-
Modifications to backboneContains U6-driven sgRNA cassette
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNmeABE8e
-
Alt nameNme2Cas9-ABE8e
-
Alt nameNme2Cas9c-ABE8e
-
SpeciesN. meningitidis
-
Insert Size (bp)3996
- Promoter U1a promoter
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gccaccatgaaaagaaccgc
- 3′ sequencing primer ctagagcgcttacacaaaaaacca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS-HZ79 All-in-one AAV-U1a-NmeABE8e-2xBPSV40-U6-Rosa26_V2 was a gift from Erik Sontheimer (Addgene plasmid # 199261 ; http://n2t.net/addgene:199261 ; RRID:Addgene_199261) -
For your References section:
Adenine Base Editing In Vivo with a Single Adeno-Associated Virus Vector. Zhang H, Bamidele N, Liu P, Ojelabi O, Gao XD, Rodriguez T, Cheng H, Kelly K, Watts JK, Xie J, Gao G, Wolfe SA, Xue W, Sontheimer EJ. GEN Biotechnol. 2022 Jun 1;1(3):285-299. doi: 10.1089/genbio.2022.0015. Epub 2022 Jun 14. 10.1089/genbio.2022.0015 PubMed 35811581