Skip to main content
Addgene

pUC18T-mini-Tn7T-Gm-Pc-sfGFP
(Plasmid #199248)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199248 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC18R6K-mini-Tn7T-Gm and pUC18T-mini-Tn7T
  • Backbone size w/o insert (bp) 4521
  • Total vector size (bp) 4780
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Codon-optimized sfGFP gene
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Mutation
    Codon optimization for Xanthomonadaceae
  • GenBank ID
    WAK86295.1
  • Promoter Pc promoter from class III integron of Delftia acidovorans C17, synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer TACGAACCGAACAGGCTTATGTC
  • 3′ sequencing primer GTTGGCCGATTCATTAATGCAGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC18T-mini-Tn7T-Gm-Pc-sfGFP was a gift from Uwe Mamat (Addgene plasmid # 199248 ; http://n2t.net/addgene:199248 ; RRID:Addgene_199248)

  • For your References section:

    Improved mini-Tn7 Delivery Plasmids for Fluorescent Labeling of Stenotrophomonas maltophilia. Mamat U, Hein M, Grella D, Taylor CS, Scholzen T, Alio I, Streit WR, Huedo P, Coves X, Conchillo-Sole O, Gomez AC, Gibert I, Yero D, Schaible UE. Appl Environ Microbiol. 2023 May 17:e0031723. doi: 10.1128/aem.00317-23. 10.1128/aem.00317-23 PubMed 37195181
Related items:
Commonly requested with: