pUC18T-mini-Tn7T-Gm-Pc-mCherry
(Plasmid #199247)

• Purpose: Fluorescent labelling of bacterial cells with mCherry
• Depositing Lab: Uwe Mamat
• Publication: Mamat et al Appl Environ Microbiol. 2023 May 17:e0031723. doi: 10.1128/aem.00317-23.

Backbone

• Vector backbone: pUC18R6K-mini-Tn7T-Gm and pUC18T-mini-Tn7T
• Backbone size w/o insert (bp): 4778
• Total vector size (bp): 5489
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Codon-optimized mCherry gene
• Species: Synthetic
• Insert Size (bp): 711
• Mutation: Codon optimization for Xanthomonadaceae
• GenBank ID: WAK86292.1
• Promoter: Pc promoter from class III integron of Delftia acidovorans C17, synthetic

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: TACGAACCGAACAGGCTTATGTC
• 3′ sequencing primer: GTTGGCCGATTCATTAATGCAGC

Resource Information

• Supplemental Documents:
  • pUC18T-mini-Tn7T-Gm-Pc-mCherry.gb
• A portion of this plasmid was derived from a plasmid made by: Synthetic codon-optimized gene

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry