Skip to main content
Addgene

SPDK3959
(Plasmid #199246)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199246 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAMBIS0390 T-DNA vector
  • Backbone size w/o insert (bp) 6812
  • Total vector size (bp) 11056
  • Vector type
    T-DNA vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    We prefer to grow in DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Modified TRV RNA2 with PEBV promoter, AtPDS3 target and AtIleu-tRNA mobile RNA sequence
  • Insert Size (bp)
    2956
  • Promoter PEBV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site SacI (unknown if destroyed)
  • 5′ sequencing primer CATAATTATACTGATTTGTCTCTCG
  • 3′ sequencing primer caaaagacttaccgatcaatcaag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SPDK3959 was a gift from Savithramma Dinesh-Kumar (Addgene plasmid # 199246 ; http://n2t.net/addgene:199246 ; RRID:Addgene_199246)
  • For your References section:

    High-efficiency multiplex biallelic heritable editing in Arabidopsis using an RNA virus. Nagalakshmi U, Meier N, Liu JY, Voytas DF, Dinesh-Kumar SP. Plant Physiol. 2022 Jun 27;189(3):1241-1245. doi: 10.1093/plphys/kiac159. 10.1093/plphys/kiac159 PubMed 35389493