pUBQ:Citrine-TurboID-3xMyc
(Plasmid #199244)

• Purpose: This plasmid could be used to clone gene(protein) of interest in place of Citrine to use in proximity labeling approach in plants.
• Depositing Lab: Savithramma Dinesh-Kumar
• Publication: Zhang et al Nat Commun. 2019 Jul 19;10(1):3252. doi: 10.1038/s41467-019-11202-z.

Backbone

• Vector backbone: pCambia3300
• Backbone size w/o insert (bp): 8396
• Total vector size (bp): 11776
• Vector type: Plant Expression
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Citrine-TurboID-3xMyc
• Species: Synthetic
• Insert Size (bp): 1798
• Promoter: Arabidopsis UBQ10 promoter with intron
• Tag / Fusion Protein:
  • TurboID-3xMyc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: StuI (unknown if destroyed)
• 3′ cloning site: AvrII (unknown if destroyed)
• 5′ sequencing primer: ctgttaatcttagatcgaagacg
• 3′ sequencing primer: catcgcaagaccggcaacaggattc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: TurboID is from Alice Ting

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry