p35S:Citrine-TurboID-3xHA
(Plasmid #199243)

• Purpose: This plasmid could be used to clone gene(protein) of interest in place of Citrine to use in proximity labeling approach in plants.
• Depositing Lab: Savithramma Dinesh-Kumar
• Publication: Zhang et al Nat Commun. 2019 Jul 19;10(1):3252. doi: 10.1038/s41467-019-11202-z.

Backbone

• Vector backbone: pCambia2300
• Backbone size w/o insert (bp): 8715
• Total vector size (bp): 11515
• Vector type: Plant Expression
• Selectable markers: Kanamycin (NPTII)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Citrine-TurboID
• Species: Synthetic
• Insert Size (bp): 1680
• Promoter: CaMV 35S
• Tags / Fusion Proteins:
  • TurboID-3xHA (C terminal on insert)
  • 3xHA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: AvrII (unknown if destroyed)
• 5′ sequencing primer: ggtggcatcgccctcgccctcgc
• 3′ sequencing primer: catcgcaagaccggcaacaggattc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: TurboID is from Alice Ting lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry