Skip to main content
Addgene

pUt-mPF-BACH1 Cas9-Resistant_AmpR
(Plasmid #199221)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199221 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUt-mNF-BACH1
  • Backbone manufacturer
    Balazsi Lab
  • Backbone size w/o insert (bp) 7902
  • Total vector size (bp) 9925
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rtTA-Advanced::P2A::EGFP::BACH1
  • Alt name
    reverse tetracycline Transactivator
  • Alt name
    BTB Domain And CNC Homolog 1
  • Alt name
    EGFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3759
  • Mutation
    silient mutation at nucleic acid 177 C changed to T
  • GenBank ID
    NM_206866
  • Entrez Gene
    BACH1 (a.k.a. BACH-1, BTBD24)
  • Promoter tight TRE promoter
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATATACGCGTCGAGGCCCTTTC
  • 3′ sequencing primer GATGAGTAAACCGGTGCGGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUt-mPF-BACH1 Cas9-Resistant_AmpR was a gift from Gabor Balazsi (Addgene plasmid # 199221 ; http://n2t.net/addgene:199221 ; RRID:Addgene_199221)

  • For your References section:

    Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268
Related items:
Commonly requested with: