Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUt-mNF-BACH1
(Plasmid #199219)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 199219 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDN-D2irTN2AG5kwh
  • Backbone manufacturer
    Balazsi Lab
  • Backbone size w/o insert (bp) 5090
  • Total vector size (bp) 7546
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Blasticidin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hTetR::P2A::EGFP::BACH1
  • Alt name
    Tetracycline Repressor codon-optimized for human
  • Alt name
    BTB Domain And CNC Homolog 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3657
  • GenBank ID
    NM_206866
  • Entrez Gene
    BACH1 (a.k.a. BACH-1, BTBD24)
  • Promoter CMV D2ir promoter
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACATTGATTATTGACTAGTTATTAA
  • 3′ sequencing primer CCATAGAGCCCACCGCATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUt-mNF-BACH1 was a gift from Gabor Balazsi (Addgene plasmid # 199219 ; http://n2t.net/addgene:199219 ; RRID:Addgene_199219)
  • For your References section:

    Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268