pUt-mNF-BACH1 Cas9-Resistant
(Plasmid #199218)

• Purpose: LPUtopia-7 matching RMCE donor plasmid with Cas9-resistant GFP-BACH1 Negative-Feedback circuit (mNF-BACH1 Cas9- resistant). Use BlastR for positive selection and HSV-TK for negative selection. 
• Depositing Lab: Gabor Balazsi
• Publication: Wan et al Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25.

Backbone

• Vector backbone: pUt-mNF-BACH1
• Backbone manufacturer: Balazsi Lab
• Backbone size w/o insert (bp): 7717
• Total vector size (bp): 9925
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Blasticidin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hTetR::P2A::EGFP::BACH1
• Alt name: Tetracycline Repressor codon-optimized for human
• Alt name: BTB Domain And CNC Homolog 1
• Species: H. sapiens (human)
• Insert Size (bp): 3657
• Mutation: silient mutation at nucleic acid 177 C changed to T
• GenBank ID: NM_206866
• Entrez Gene: BACH1 (a.k.a. BACH-1, BTBD24)
• Promoter: CMV D2ir promoter
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGTCTCTGAGTGAGAACTC
• 3′ sequencing primer: GATGAGTAAACCGGTGCGGC

Resource Information

• Supplemental Documents:
  • pUt-mNF-BACH1 Cas9-Resistant.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry