pUC_hU6-shRKIP_BFP
(Plasmid
#199216)
-
PurposeExpression plasmid with shRNAmiR targeting RKIP (PEBP1), with a BFP reporter on the backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199216 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSLQ5429_pUC_hU6-crScaffold_EF1a-BFP
-
Backbone manufacturerStanley Qi Lab
- Backbone size w/o insert (bp) 4249
- Total vector size (bp) 4404
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshBACH1
-
Alt namesmall hairpin RNA targeting BACH1
-
gRNA/shRNA sequenceTGAATCAAGACCATCCCACGAA
-
SpeciesSynthetic
-
Entrez GeneBACH1 (a.k.a. BACH-1, BTBD24)
- Promoter human U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGGAAAGGACGCGACTTCT
- 3′ sequencing primer AGTACtagaaCTCCCCAGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC_hU6-shRKIP_BFP was a gift from Gabor Balazsi (Addgene plasmid # 199216 ; http://n2t.net/addgene:199216 ; RRID:Addgene_199216) -
For your References section:
Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268