pEGFP-C2-GGA2
(Plasmid #199172)

• Purpose: Expresses GFP-GGA2 fusion in mammalian cells
• Depositing Lab: Juan Bonifacino
• Publication: Mattera et al EMBO J. 2003 Jan 2;22(1):78-88. doi: 10.1093/emboj/cdg015.

Backbone

• Vector backbone: pEGFP-C2
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 6604
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GGA2
• Species: H. sapiens (human)
• Insert Size (bp): 1863
• Mutation: Ala 23 Thr substitution; silent substitution in codon 66
• Entrez Gene: GGA2 (a.k.a. VEAR)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pEGFP-C forward: 5’ CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: pEGFP-C reverse: 5’ GCTTTATTTGTGAAATTTGTGATGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

GGA2 insert was excised with EcoRI using limiting amounts of restriction enzyme (partial digestion). The internal EcoRI site in human GGA2 cDNA is intact. Construct contains an additional 21 bp after stop codon before EcoRI site at 3'.