Skip to main content
Addgene

pDS170-enNTS1
(Plasmid #199152)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199152 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDS170
  • Backbone manufacturer
    Internal Lab Plasmid
  • Backbone size w/o insert (bp) 6112
  • Total vector size (bp) 7234
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    enNTS1
  • Alt name
    Thermostabilised rat neurotensin receptor 1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1122
  • Mutation
    V208M, C273S, C391S and C393S (over NTS1-B5)
  • Entrez Gene
    Ntsr1 (a.k.a. Ntsr)
  • Promoter Lac/T5
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • muGFP (C terminal on backbone)
    • 10xHis tag (N terminal on backbone)
    • Avi tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTGAAAGACGCGCAGAC
  • 3′ sequencing primer ATCCATGCCATGTGTAATCCCAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For additional information, please refer to:
Bumbak et al. 2018 "Optimization and 13CH3 methionine labeling of a signaling competent neurotensin receptor 1 variant for NMR studies" BBA Biomembranes. https://doi.org/10.1016/j.bbamem.2018.03.020
Bumbak et al. 2019 "Expression and Purification of a Functional E. coli 13CH3-Methionine-Labeled Thermostable Neurotensin Receptor 1 Variant for Solution NMR Studies" Methods Mol Biol. https://doi.org/10.1007/978-1-4939-9121-1_3

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDS170-enNTS1 was a gift from Daniel Scott (Addgene plasmid # 199152 ; http://n2t.net/addgene:199152 ; RRID:Addgene_199152)

  • For your References section:

    Ligands selectively tune the local and global motions of neurotensin receptor 1 (NTS(1)). Bumbak F, Pons M, Inoue A, Paniagua JC, Yan F, Wu H, Robson SA, Bathgate RAD, Scott DJ, Gooley PR, Ziarek JJ. Cell Rep. 2023 Jan 31;42(1):112015. doi: 10.1016/j.celrep.2023.112015. Epub 2023 Jan 20. 10.1016/j.celrep.2023.112015 PubMed 36680775
Related items:
Commonly requested with: