NeuA.pJL1
(Plasmid #199115)

• Purpose: In vitro expression of N-acylneuraminate cytodiylyltransfease (NeuA), which conjugates sialic acid and CTP to make activated sugar donor, CMP-sialic acid (see CSTI.PJL1 and PdST6.PJL1)
• Depositing Lab: Michael Jewett
• Publication: Thames et al ACS Synth Biol. 2023 Apr 11. doi: 10.1021/acssynbio.3c00017.

Backbone

• Vector backbone: pJL1
• Backbone size w/o insert (bp): 1763
• Total vector size (bp): 3050
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: N-acylneuraminate cytodiylyltransfease (NeuA)
• Alt name: CMP-sialic acid synthase
• Species: Escherichia coli
• Insert Size (bp): 1287
• Promoter: T7
• Tag / Fusion Protein:
  • Strep-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGTTATTGCTCAGCGGTGG

Resource Information

• Supplemental Documents:
  • NeuA.pJL1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry