eGFP Y93H AC editing reporter
(Plasmid
#198883)
-
PurposeExpress eGFP fluorescence after Y93H correction and mCherry as transfection control
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti-CMV-mCherry-T2A-eGFP-Gly92(GGT)-His93(CAC)-Hygro
- Backbone size w/o insert (bp) 11182
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameenhanced green fluorescent protein
-
Alt nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)1503
-
MutationY93H, Gly92(GGT-to-GGA)
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctggctaccggtatggtgagcaagggcgagg
- 3′ sequencing primer CTTGTACTCGAGATCTGCACCGGGCTTGTACAGCTCGTCCATGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also expresses mCherry (with T2A cleavage site)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eGFP Y93H AC editing reporter was a gift from Reuben Harris (Addgene plasmid # 198883 ; http://n2t.net/addgene:198883 ; RRID:Addgene_198883) -
For your References section:
APOBEC Reporter Systems for Evaluating diNucleotide Editing Levels. Rieffer AE, Chen Y, Salamango DJ, Moraes SN, Harris RS. CRISPR J. 2023 Oct;6(5):430-446. doi: 10.1089/crispr.2023.0027. Epub 2023 Sep 6. 10.1089/crispr.2023.0027 PubMed 37672599