Skip to main content
Addgene

pGL3-MTS-ATP6-W68-R17-G1333N-UGI-Puro
(Plasmid #198839)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198839 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP6-W68-R17 TALEN
  • Species
    R. norvegicus (rat)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-MTS-ATP6-W68-R17-G1333N-UGI-Puro was a gift from Bin Shen (Addgene plasmid # 198839 ; http://n2t.net/addgene:198839 ; RRID:Addgene_198839)
  • For your References section:

    A conditional knockout rat resource of mitochondrial protein-coding genes via a DdCBE-induced premature stop codon. Tan L, Qi X, Kong W, Jin J, Lu D, Zhang X, Wang Y, Wang S, Dong W, Shi X, Chen W, Wang J, Li K, Xie Y, Gao L, Guan F, Gao K, Li C, Wang C, Hu Z, Zhang L, Guo X, Shen B, Ma Y. Sci Adv. 2023 Apr 14;9(15):eadf2695. doi: 10.1126/sciadv.adf2695. Epub 2023 Apr 14. 10.1126/sciadv.adf2695 PubMed 37058569