Skip to main content
Addgene

pLKO.1-Teton-puro-shPP1C #1
(Plasmid #198762)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198762 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLKO.1-Teton-puromycin
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shPP1C #1
  • gRNA/shRNA sequence
    CCGGGCGAATTATGCGACCAACTGACTCGAGTCAGTTGGTCGCATAATTCGCTTTTTG
  • Species
    H. sapiens (human)
  • Entrez Gene
    PPP1CC (a.k.a. PP-1G, PP1C, PPP1G)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-Teton-puro-shPP1C #1 was a gift from Hyonchol Jang (Addgene plasmid # 198762 ; http://n2t.net/addgene:198762 ; RRID:Addgene_198762)

  • For your References section:

    Phosphorylation of OCT4 Serine 236 Inhibits Germ Cell Tumor Growth by Inducing Differentiation. Kim DK, Song B, Han S, Jang H, Bae SH, Kim HY, Lee SH, Lee S, Kim JK, Kim HS, Hong KM, Lee BI, Youn HD, Kim SY, Kang SW, Jang H. Cancers (Basel). 2020 Sep 11;12(9):2601. doi: 10.3390/cancers12092601. 10.3390/cancers12092601 PubMed 32932964
Related items: