pLKO.1-Teton-puro-shOCT4
(Plasmid
#198761)
-
Purposeconditional knockdown of OCT4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1-Teton-puromycin
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshOCT4
-
gRNA/shRNA sequenceCCGGTCATTCACTAAGGAAGGAATTCTCGAGAATTCCTTCCTTAGTGAATGATTTTTG
-
SpeciesH. sapiens (human)
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-Teton-puro-shOCT4 was a gift from Hyonchol Jang (Addgene plasmid # 198761 ; http://n2t.net/addgene:198761 ; RRID:Addgene_198761) -
For your References section:
Phosphorylation of OCT4 Serine 236 Inhibits Germ Cell Tumor Growth by Inducing Differentiation. Kim DK, Song B, Han S, Jang H, Bae SH, Kim HY, Lee SH, Lee S, Kim JK, Kim HS, Hong KM, Lee BI, Youn HD, Kim SY, Kang SW, Jang H. Cancers (Basel). 2020 Sep 11;12(9):2601. doi: 10.3390/cancers12092601. 10.3390/cancers12092601 PubMed 32932964