DiLiCre 2.0
(Plasmid #198752)

• Purpose: A Cre recombinase that is expressed upon doxycycline when combined with the UbC-blasticidine-P2A-TETon-3G transactivator. DiLiCre 2.0 is a cre recombinase that is activated by violet light.
• Depositing Lab: Jacco van Rheenen
• Publication: Vizoso et al Nat Commun. 2022 Oct 28;13(1):6442. doi: 10.1038/s41467-022-33863-z.

Backbone

• Vector backbone: #71666 pdCas9-DNMT3A-EGFP
• Backbone manufacturer: Vlatka Zoldos
• Backbone size w/o insert (bp): 8020
• Total vector size (bp): 12093
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral
• Selectable markers: Zeocin ; Bleomycin, Phleomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cre-PhoCI-ERT2-ERT2
• Alt name: DiLiCre 2.0
• Species: Synthetic
• Insert Size (bp): 3686
• GenBank ID:
• Promoter: TRE3GV
• Tag / Fusion Protein:
  • Cre, kept in a photocleavable site, followed by 2 ERT2 domains. (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GAAGAGGTACACCAGCACCAAAG
• 3′ sequencing primer: cgaggtcgacggtatcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: backbone: pdCas9-DNMT3A-EGFP (Vlatka Zoldoš), DNA fragments: pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 (Robert Campbell), TRE-KRAB-dCas9-IRES-GFP (Eric Lander). For more information: see comments

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloning was performed using a third generation lentiviral plasmid as a backbone (pdCas9-DNMT3A-EGFP (Vlatka Zoldoš, #71666)) digested with NheI-EcoRI and ligated to the following DNA fragments: TREGV 3rd generation promoter (amplified by PCR using TRE-KRAB-dCas9-IRES-GFP (Eric Lander, #85556) as a template and digested with NheI-XmaI), PhoCl-ERT2-Cre-ERT2-PhoCl sequence (pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 (Robert Campbell, #87694)) digested with XmaI-NotI, and NotI-EcoRI adapter. From construct PhoCl-ERT2-Cre-ERT2-PhoCl, the sequence Cre-PhoCl-ERT2 was amplified. Cre sequence from the original construct lacked the canonical first 16 aminoacids (MANLLTVHQNLPALPV), so we restored them. The synthesized fragment was ligated into the pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 vector upon PacI and EcoRI digestion. Using this as a template, we amplified Cre-PhoCl-ERT2 sequence to generate a new fragment flanked by PacI and AscI restriction sites. An additional ERT2 domain was synthetized by PCR with AscI and EcoRI ends and one 5′-GSGSGGG flexible linker. Upon digestion, the two fragments were ligated into the pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 vector upon PacI and EcoRI digestion. Finally, Cre-PhoCl-ERT2(x2) fragment was jumped into the PiggyBac XLone vector system25. To this end, XLone plasmid backbone was PCR and Cre-PhoCl-ERT2(x2) cassette ligated upon NheI-NotI digestion.