pAAV_CaMKIIa_SERT_EYFP
(Plasmid
#198737)
-
PurposeSerotonin transporter with EYFP fluorescent protein driven by CaMKIIa promoter on a AAV vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198737 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-CaMKIIa
- Backbone size w/o insert (bp) 5367
- Total vector size (bp) 7995
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSerotonin transporter and yellow fluorescent protein
-
Alt nameSERT-EYFP
-
SpeciesSynthetic
-
Insert Size (bp)2628
- Promoter CaMKIIa
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CGAAGGCTCGCGAGGCTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_CaMKIIa_SERT_EYFP was a gift from Lin Tian (Addgene plasmid # 198737 ; http://n2t.net/addgene:198737 ; RRID:Addgene_198737) -
For your References section:
Psychedelics promote neuroplasticity through the activation of intracellular 5-HT2A receptors. Vargas MV, Dunlap LE, Dong C, Carter SJ, Tombari RJ, Jami SA, Cameron LP, Patel SD, Hennessey JJ, Saeger HN, McCorvy JD, Gray JA, Tian L, Olson DE. Science. 2023 Feb 17;379(6633):700-706. doi: 10.1126/science.adf0435. Epub 2023 Feb 16. 10.1126/science.adf0435 PubMed 36795823