RhoC gRNA #2
(Plasmid
#198725)
-
PurposeCas9-mediated knockout of RhoC in mammalian cells #2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonegRNA backbone
- Backbone size w/o insert (bp) 2733
- Total vector size (bp) 2813
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRhoC
-
gRNA/shRNA sequencectatatagccgacatcgaagtgg
-
SpeciesM. musculus (mouse)
-
Entrez GeneRhoc (a.k.a. Arh9, Arhc)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer None
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/625616 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RhoC gRNA #2 was a gift from Takeshi Imai (Addgene plasmid # 198725 ; http://n2t.net/addgene:198725 ; RRID:Addgene_198725) -
For your References section:
Activity-dependent local protection and lateral inhibition control synaptic competition in developing mitral cells in mice. Fujimoto S, Leiwe MN, Aihara S, Sakaguchi R, Muroyama Y, Kobayakawa R, Kobayakawa K, Saito T, Imai T. Dev Cell. 2023 Jul 24;58(14):1221-1236.e7. doi: 10.1016/j.devcel.2023.05.004. Epub 2023 Jun 7. 10.1016/j.devcel.2023.05.004 PubMed 37290446