Skip to main content
Addgene

RhoB gRNA #1
(Plasmid #198721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198721 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    gRNA backbone
  • Backbone size w/o insert (bp) 2733
  • Total vector size (bp) 2813
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RhoB
  • gRNA/shRNA sequence
    cggtgggcacgtacacctcgggg
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Rhob (a.k.a. Arh6, Arhb)
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/625616 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RhoB gRNA #1 was a gift from Takeshi Imai (Addgene plasmid # 198721 ; http://n2t.net/addgene:198721 ; RRID:Addgene_198721)
  • For your References section:

    Activity-dependent local protection and lateral inhibition control synaptic competition in developing mitral cells in mice. Fujimoto S, Leiwe MN, Aihara S, Sakaguchi R, Muroyama Y, Kobayakawa R, Kobayakawa K, Saito T, Imai T. Dev Cell. 2023 Jul 24;58(14):1221-1236.e7. doi: 10.1016/j.devcel.2023.05.004. Epub 2023 Jun 7. 10.1016/j.devcel.2023.05.004 PubMed 37290446