pINQ-NbH4
(Plasmid
#198690)
-
PurposePeriplasmic expression of anti-SARS-Cov-2 Nucleocapsid nanobody H4 (AviTag) in BL21(DE3)
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198690 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a(+)
- Backbone size w/o insert (bp) 5186
- Total vector size (bp) 5737
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameanti-SARS-CoV-2 Nucleocapsid nanobody H4
-
Alt nameNbH4
-
Insert Size (bp)551
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- Ribosome binding site (N terminal on insert)
- OmpA signal peptide (N terminal on insert)
- Avitag (C terminal on insert)
- 6xHis tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINQ-NbH4 was a gift from Gualberto González Sapienza (Addgene plasmid # 198690 ; http://n2t.net/addgene:198690 ; RRID:Addgene_198690) -
For your References section:
A highly sensitive nanobody-based immunoassay detecting SARS-CoV-2 nucleocapsid protein using all-recombinant reagents. Segovia-de Los Santos P, Padula-Roca C, Simon X, Echaides C, Lassabe G, Gonzalez-Sapienza G. Front Immunol. 2023 Jul 11;14:1220477. doi: 10.3389/fimmu.2023.1220477. eCollection 2023. 10.3389/fimmu.2023.1220477 PubMed 37497229