Skip to main content
Addgene

pINQ-ON10
(Plasmid #198689)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198689 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a(+)
  • Backbone size w/o insert (bp) 5186
  • Total vector size (bp) 5767
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    anti-SARS-CoV-2 Nucleocapsid nanobody ON10
  • Alt name
    NbON10
  • Insert Size (bp)
    581
  • Promoter T7 promoter
  • Tags / Fusion Proteins
    • Ribosome binding site (N terminal on insert)
    • OmpA signal peptide (N terminal on insert)
    • 6xHis tag (C terminal on insert)
    • HA tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINQ-ON10 was a gift from Gualberto González Sapienza (Addgene plasmid # 198689 ; http://n2t.net/addgene:198689 ; RRID:Addgene_198689)
  • For your References section:

    A highly sensitive nanobody-based immunoassay detecting SARS-CoV-2 nucleocapsid protein using all-recombinant reagents. Segovia-de Los Santos P, Padula-Roca C, Simon X, Echaides C, Lassabe G, Gonzalez-Sapienza G. Front Immunol. 2023 Jul 11;14:1220477. doi: 10.3389/fimmu.2023.1220477. eCollection 2023. 10.3389/fimmu.2023.1220477 PubMed 37497229