Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTG131
(Plasmid #198640)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198640 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSC101ts
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Alt name
    SpCas9
  • Alt name
    SpyCas9
  • GenBank ID
    SQF23182
  • Promoter pPhlF

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ttgacatgatacgaaacgtaccg
  • 3′ sequencing primer ATTGAAAAAACCTCGCGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTG131 was a gift from David Bikard (Addgene plasmid # 198640 ; http://n2t.net/addgene:198640 ; RRID:Addgene_198640)
  • For your References section:

    Cas9 off-target binding to the promoter of bacterial genes leads to silencing and toxicity. Rostain W, Grebert T, Vyhovskyi D, Pizarro PT, Tshinsele-Van Bellingen G, Cui L, Bikard D. Nucleic Acids Res. 2023 Mar 17:gkad170. doi: 10.1093/nar/gkad170. 10.1093/nar/gkad170 PubMed 36929199