pTG131
(Plasmid
#198640)
-
PurposeThermosensitive pSC101-based plasmid expressing a sgRNA under the control of the J23119 promoter and Cas9 under the control of the DAPG-inducible PhlF promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSC101ts
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas9
-
Alt nameSpCas9
-
Alt nameSpyCas9
-
GenBank IDSQF23182
- Promoter pPhlF
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttgacatgatacgaaacgtaccg
- 3′ sequencing primer ATTGAAAAAACCTCGCGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTG131 was a gift from David Bikard (Addgene plasmid # 198640 ; http://n2t.net/addgene:198640 ; RRID:Addgene_198640) -
For your References section:
Cas9 off-target binding to the promoter of bacterial genes leads to silencing and toxicity. Rostain W, Grebert T, Vyhovskyi D, Pizarro PT, Tshinsele-Van Bellingen G, Cui L, Bikard D. Nucleic Acids Res. 2023 Mar 17:gkad170. doi: 10.1093/nar/gkad170. 10.1093/nar/gkad170 PubMed 36929199