psiCHECK c2orf42 3'UTR
(Plasmid
#19862)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 19862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepsiCHECK-2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6249
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namec2orf42 3'UTR
-
Alt namec2orf42
-
SpeciesH. sapiens (human)
-
Insert Size (bp)492
-
GenBank IDNM_001017923
-
Entrez GeneC2orf42 (a.k.a. FLJ20558)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTACATCAAGAGCTTCGTGG
- 3′ sequencing primer AAGACTCATTTAGATCCTCACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK c2orf42 3'UTR was a gift from Thomas Tuschl (Addgene plasmid # 19862 ; http://n2t.net/addgene:19862 ; RRID:Addgene_19862) -
For your References section:
Molecular characterization of human Argonaute-containing ribonucleoprotein complexes and their bound target mRNAs. Landthaler M, Gaidatzis D, Rothballer A, Chen PY, Soll SJ, Dinic L, Ojo T, Hafner M, Zavolan M, Tuschl T. RNA. 2008 Oct 31. ():. 10.1261/rna.1351608 PubMed 18978028
Map uploaded by the depositor.
