Skip to main content
Addgene

pMXs-IRES-blast GFP-SPNS1(E164K)
(Plasmid #198572)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198572 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMXs-IRES-blast
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 8000
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SPNS1(E164K) with n-terminal 3xFlag-GFP fusion
  • Alt name
    3xFlag-GFP-SPNS1(E164K)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2322
  • Mutation
    changed glutamic acid E164 to lysine (E164K)
  • Entrez Gene
    SPNS1 (a.k.a. HSpin1, LAT, PP2030, SLC62A1, SLC63A1, SPIN1, SPINL, nrs)
  • Tag / Fusion Protein
    • 3xFlag-GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CTTGGATACACGCCGCCCAC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    codon-optimized SPNS1 orf was amplified from pDONR221_SPNS1 plasmid (Addgene Plasmid #132273)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-IRES-blast GFP-SPNS1(E164K) was a gift from Monther Abu-Remaileh (Addgene plasmid # 198572 ; http://n2t.net/addgene:198572 ; RRID:Addgene_198572)

  • For your References section:

    An SPNS1-dependent lysosomal lipid transport pathway that enables cell survival under choline limitation. Scharenberg SG, Dong W, Ghoochani A, Nyame K, Levin-Konigsberg R, Krishnan AR, Rawat ES, Spees K, Bassik MC, Abu-Remaileh M. Sci Adv. 2023 Apr 21;9(16):eadf8966. doi: 10.1126/sciadv.adf8966. Epub 2023 Apr 19. 10.1126/sciadv.adf8966 PubMed 37075117
Related items: