pMXs-3xFlag-SPNS1
(Plasmid
#198568)
-
PurposeSPNS1 codon-optimized orf with n-terminal 3xFlag in pMXs-IRES-Blast vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMXs-IRES-blast
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7300
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSPNS1 with n-terminal 3xFlag
-
Alt name3xFlag-SPNS1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1683
-
Entrez GeneSPNS1 (a.k.a. HSpin1, LAT, PP2030, SLC62A1, SLC63A1, SPIN1, SPINL, nrs)
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CTTGGATACACGCCGCCCAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycodon-optimized SPNS1 orf was amplified from pDONR221_SPNS1 plasmid (Addgene Plasmid #132273)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.11.27.517422v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-3xFlag-SPNS1 was a gift from Monther Abu-Remaileh (Addgene plasmid # 198568 ; http://n2t.net/addgene:198568 ; RRID:Addgene_198568) -
For your References section:
An SPNS1-dependent lysosomal lipid transport pathway that enables cell survival under choline limitation. Scharenberg SG, Dong W, Ghoochani A, Nyame K, Levin-Konigsberg R, Krishnan AR, Rawat ES, Spees K, Bassik MC, Abu-Remaileh M. Sci Adv. 2023 Apr 21;9(16):eadf8966. doi: 10.1126/sciadv.adf8966. Epub 2023 Apr 19. 10.1126/sciadv.adf8966 PubMed 37075117