SpCas9-NRCH-CGBE1
(Plasmid
#198557)
-
PurposeExpresses human codon-optimized SpCas9-NRCH-CGBE1 and blasticidin resistance: EFS promoter-SpCas9-NRCH-CGBE1-NLS-FLAG-P2A-BSD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198557 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFUGW
- Total vector size (bp) 14412
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9-NRCH-CGBE1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6204
- Promoter EFS
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- FLAG (C terminal on insert)
- BSD (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer 5' - ggtcttgaaaggagtgggaattgg - 3'
- 3′ sequencing primer 5' - CAGGTCGCTTGTCGCCTCC - 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SpCas9-NRCH-CGBE1 was a gift from Hyongbum Kim (Addgene plasmid # 198557 ; http://n2t.net/addgene:198557 ; RRID:Addgene_198557) -
For your References section:
Deep learning models to predict the editing efficiencies and outcomes of diverse base editors. Kim N, Choi S, Kim S, Song M, Seo JH, Min S, Park J, Cho SR, Kim HH. Nat Biotechnol. 2024 Mar;42(3):484-497. doi: 10.1038/s41587-023-01792-x 10.1038/s41587-023-01792-x PubMed 37188916