pCI-neo-(HA)3-ε
(Plasmid #198531)

• Purpose: Expression of HA-tagged AP-4 ε in mammalian cells
• Depositing Lab: Juan Bonifacino
• Publication: Mattera et al Proc Natl Acad Sci U S A. 2017 Dec 12;114(50):E10697-E10706. doi: 10.1073/pnas.1717327114. Epub 2017 Nov 27.

Backbone

• Vector backbone: pCI-neo
• Backbone size w/o insert (bp): 5474
• Total vector size (bp): 8971
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: AP-4 ε
• Species: H. sapiens (human)
• Insert Size (bp): 3522
• Mutation: silent substitutions in codons 235, 262, 905 and 1129
• Entrez Gene: AP4E1 (a.k.a. CPSQ4, SPG51, STUT1)
• Promoter: CMV
• Tag / Fusion Protein:
  • triple HA tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
• 3′ sequencing primer: pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

triple HA tag subcloned between XhoI and EcoRI sites, AP-4 ε subcloned betwen EcoRI and SalI sites; all sites are intact