pEGFPN1-ATG9A
(Plasmid #198529)

• Purpose: Expression of ATG9A-GFP fusion protein in mammalian cells
• Depositing Lab: Juan Bonifacino
• Publication: Mattera et al Proc Natl Acad Sci U S A. 2017 Dec 12;114(50):E10697-E10706. doi: 10.1073/pnas.1717327114. Epub 2017 Nov 27.

Backbone

• Vector backbone: pEGFP-N1
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 7250
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ATG9A
• Species: H. sapiens (human)
• Insert Size (bp): 2517
• Mutation: silent mutations in codons 4 and 775
• Entrez Gene: ATG9A (a.k.a. APG9L1, MGD3208, mATG9)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: pEGFP-N forward: 5’ CATTGACGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: pEGFP-N reverse: 5’ GTGGCCGTTTACGTCGCCGTCCAGCTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry