pAAV_hSyn-PdCO-EGFP-WPRE
(Plasmid #198513)

• Purpose: Expresses optimized PdCO in frame with EGFP under control of human synapsin1 promotor.
• Depositing Lab: Ofer Yizhar
• Publication: Wietek et al Nat Methods. 2024 May 29. doi: 10.1038/s41592-024-02285-8.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 3899
• Total vector size (bp): 5816
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PdCO
• Alt name: Platynereis dumerilii Ciliary Opsin, optimized for mammalian neuron expression and enhanced axonal membrane trafficking
• Species: Synthetic; Platynereis dumerilii
• Insert Size (bp): 1917
• GenBank ID: AY692353.1
• Promoter: hSyn1
• Tags / Fusion Proteins:
  • EGFP (C terminal on insert)
  • Rho1D4 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: hSyn_F (ttcagcaccgcggacagtg)
• 3′ sequencing primer: WPRE_R (ACCACGGAATTATCAGTGCCCA)

Resource Information

• Supplemental Documents:
  • Copy of D800_pAAV_hSyn-PdCO-TS-EGFP-ER-WPRE.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.07.01.547328v1 for bioRxiv preprint.

Information for AAV1 (Catalog # 198513-AAV1)

Purpose

Ready-to-use AAV1 particles produced from pAAV_hSyn-PdCO-EGFP-WPRE (#198513). In addition to the viral particles, you will also receive purified pAAV_hSyn-PdCO-EGFP-WPRE plasmid DNA.

Synapsin-driven expression of the optimized opsin PdCO in frame with EGFP. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
• Buffer: PBS + 0.001% Poloxamer 188 + 200 mM NaCl
• Serotype: AAV1
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV5 (Catalog # 198513-AAV5)

Purpose

Ready-to-use AAV5 particles produced from pAAV_hSyn-PdCO-EGFP-WPRE (#198513). In addition to the viral particles, you will also receive purified pAAV_hSyn-PdCO-EGFP-WPRE plasmid DNA.

Synapsin-driven expression of the optimized opsin PdCO in frame with EGFP. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
• Buffer: PBS + 0.001% Poloxamer 188 + 200 mM NaCl
• Serotype: AAV5
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: EGFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.