Lenti-guide-puro mRab12-2
(Plasmid
#198476)
-
Purposelentiviral stable expression of mRab12 gRNA 2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198476 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelenti-guide puro
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse Rab12
-
gRNA/shRNA sequenceATATACGAGTATGATCCCCT
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
Entrez GeneRab12 (a.k.a. 2900054P15Rik)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer gcctatttcccatgattccttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.17.529028v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-guide-puro mRab12-2 was a gift from Suzanne Pfeffer (Addgene plasmid # 198476 ; http://n2t.net/addgene:198476 ; RRID:Addgene_198476) -
For your References section:
Genome-wide screen reveals Rab12 GTPase as a critical activator of Parkinson's disease-linked LRRK2 kinase. Dhekne HS, Tonelli F, Yeshaw WM, Chiang CY, Limouse C, Jaimon E, Purlyte E, Alessi DR, Pfeffer SR. Elife. 2023 Oct 24;12:e87098. doi: 10.7554/eLife.87098. 10.7554/eLife.87098 PubMed 37874635