Human DsRed-Monomer CASP9 C287A Mutant
(Plasmid
#198469)
-
PurposeExpresses Human DsRed-Monomer CASP9 C287A Mutant Fusion Protein in Mammalian Cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198469 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDsRed-Monomer-Hyg-C1
-
Backbone manufacturerTakara Bio USA
- Backbone size w/o insert (bp) 5685
- Total vector size (bp) 6968
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman Caspase-9 C287A Mutant
-
Alt nameCASP-9; ICE-LAP6; Mch6; APAF-3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1283
-
MutationChanged Cysteine 287 to Alanine to eliminate protease activity
-
GenBank IDNM_001229
-
Entrez GeneCASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
- Promoter CMV
-
Tag
/ Fusion Protein
- DsRed-monomer (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal I (not destroyed)
- 3′ cloning site BamH I (not destroyed)
- 5′ sequencing primer TACAAGGCCAAGAAGCCCGTG
- 3′ sequencing primer GCTGATTATGATCAGTTATCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Human DsRed-Monomer CASP9 C287A Mutant was a gift from Hannah Rabinowich (Addgene plasmid # 198469 ; http://n2t.net/addgene:198469 ; RRID:Addgene_198469)